Научно-практический журнал
[О компании] Издательство 'Цитокины и воспаление' - Журнал 'Цитокины и Воспаление'

197376, Санкт-Петербург, ул. Акад. Павлова, д. 12,
Институт экспериментальной медицины РАМН
Тел.: (812) 543 52 14, +7 921 984 11 30, +7 921 909 55 49
Факс: (812) 543 52 14
E-mail:
Web: www.cytokines.ru


  


2016 год
1 номер

О Журнале

Текущий год
Архив

Рубрики
Подписка

NEW Книжная полка
NEW Стол заказов

Карта сайта
Правила для авторов

Поиск

Контакты
Наши партнеры:

Русский языкEnglish language
Карта сайта Написать письмо, наши координаты

Содержание | Следующая статья | Предыдущая статья

Журнал 'Цитокины и воспаление', 2011, № 4

Заказать этот номер

Заказать эту статью в PDF

Оригинальные статьи

Номер 4'2011

Полиморфизм генов генов фактора некроза опухолей α, главного регулятора-супрессора опухолей р53 и НАДФ(Н) хинон оксидоредуктазы у больных хроническим лимфолейкозом

Б.А. Бакиров, Д.О. Каримов, Т.В. Викторова

С целью определения роли полиморфных вариантов генов фактора некроза опухолей α (TNFα -308G>A), главного регулятора-супрессора опухолей белка р53 (MDM2 309T>G) и НАДФ(Н) хинон оксидоредуктазы (NQO1 609C>T) в развитии и течении хронического лимфолейкоза (ХЛЛ) проведен анализ частот генотипов и аллелей у больных ХЛЛ (n=133) и здоровых индивидов (n=196), проживающих в республике Башкортостан. Анализ распределения частот генотипов и аллелей изучаемых генов показал, что маркерами повышенного риска развития ХЛЛ являются сочетание GG и аллель G полиморфного локуса -308G>A гена TNFα, аллель G полиморфного локуса 309T>G гена MDM2, генотип CC и аллель С полиморфного локуса 609C>T гена NQO1. Цитокины и воспаление. 2011. Т. 10. № 4. С. 27–30.)

Ключевые слова: TNF-alpha, MDM2, NQO1, генетический полиморфизм, хронический лимфолейкоз.

Хронический лимфолейкоз (ХЛЛ) – это опухолевое заболевание лимфатической ткани, при котором опухолевые лимфоциты накапливаются в периферической крови, костном мозге и лимфатических узлах. ХЛЛ имеет В-клеточное происхождение и является самым частым заболеванием среди всех лейкозов у взрослых [6]. Диагноз ХЛЛ ставится уже на поздних стадиях болезни, когда присоединяются осложнения и сопутствующие заболевания. В связи с этим важной задачей является поиск прогностических критериев, позволяющих оценить риск развития ХЛЛ [6, 13].

Этиология ХЛЛ включает как влияние факторов внешней среды, так и генетические факторы. В последние годы был изучен ряд генов, продукты которых предположительно влияют на риск развития ХЛЛ, однако лишь для нескольких из них он был доказан [7].

Нарушение контроля апоптоза является решающим событием в характерном для ХЛЛ накоплении длительно живущих В-клеток в фазе G1 клеточного цикла. Одним из регуляторов апоптоза являются цитокины, в частности, фактор некроза опухолей α (TNFα; OMIM 191160). TNFα оказывает также влияние на пролиферацию опухолевых клеток и, следовательно, играет существенную роль в патогенезе заболевания. Ген TNFα, кодирующий соответствующий цитокин, располагается на коротком плече хромосомы 6 в локусе 6p21.1-6p21.3 [6, 11]. В гене описано несколько диаллельных полиморфизмов. Один из них – транзиция гуанина на аденин в положении -308 промоторной области гена TNFα (-308G>A, rs1800629) [3, 5, 12, 15].

Белок p53 — это транскрипционный фактор, регулирующий клеточный цикл, являясь супрессором образования злокачественных трансформаций клеток. При появлении клеток с повреждениями ДНК происходит активация белка р53, результатом чего является остановка клеточного цикла и репликации ДНК, а при сильном стрессовом сигнале — запуск апоптоза. Таким образом, главная функция белка р53 заключается в удалении из пула реплицирующихся клеток тех, которые несут генетические дефекты и являются потенциально онкогенными [4, 14].

В нормальных условиях, наряду с белком р53, в клетке экспрессируется главный регулятор супрессора опухолей р53 – белок MDM2 [OMIM 164785]. N-концевой домен белка MDM2 связывается с N-концевым трансактивирующим доменом белка р53, что ведет к снижению активности последнего. Из вышесказаного видно, что повышенная экспрессия белка MDM2 является онкогенным фактором, а сам белок следует отнести к протоонкогенам [1, 2, 8].

Ген белка MDM2 локализован на длинном плече 12 хромосомы в локусе 12q14.3-12q15. В этом гене нами проанализирован полиморфный вариант – трансверсия тимина на гуанин в положении 309 (309T>G, rs2279744) [9, 10].

Известно, что одной из причин развития онкологического процесса является повреждение ДНК свободными радикалами и активными молекулами кислорода. НАДФ(Н) хинон оксидоредуктаза 1 (NQO1, OMIM 125860)является цитозольным ферментом, который катализирует двухэлектронное восстановление соединений хинона и предотвращает образование свободных радикалов семихинона и активных молекул кислорода, таким образом защищая клетку от окислительного стресса. Ген NQO1 локализован на 16 хромосоме в локусе 16q22.1. Нами изучена однонуклеотидная замена циотзина на тимин в 609 положении (609C>T, rs1800566).

Целью настоящего исследования было изучение частот полиморфных вариантов генов TNAα, MDM2 и NQO1 у больных ХЛЛ и здоровых индивидов в Республике Башкортостан, а также анализ возможных ассоциаций генотипов и гаплотипов этих генов с развитием ХЛЛ.

Материалы и методы

Обследовано 133 пациента с ХЛЛ, находившихся на стационарном лечении в гематологическом отделении Республиканской клинической больницы. Средний возраст обследованных пациентов, отобранных случайным образом, составил 49,57±1,42 года. Соотношение мужчин к женщинам – 56,4 % (75) к 43,6 % (58). Все обследованные – жители Республики Башкортостан различной этнической принадлежности (русские – 62 человека (46,6 %), татары – 54 человека (40,6 %), башкиры – 17 человек (12,8 %). Клиническое обследование больных проводилось врачами больницы и включало обязательные и дополнительные методы исследования. У 57 больных с диагнозом ХЛЛ отмечалось более агрессивное течение болезни, у 67, напротив, более доброкачественное, а у 9 – переходный вариант.

В качестве контроля были использованы образцы ДНК 196 практически здоровых индивидов, жителей Республики Башкортостан, отобранные с учетом возраста (47,34±1,58 года), половой принадлежности (107 мужчин – 54,6 %, 89 женщин – 45,4 %), и этнического состава (русские – 97 человек (49,5 %), татары – 79 человек (40,3 %), башкиры – 20 человек (10,2 %)).

Материалом для молекулярно-генетического анализа служили образцы ДНК, выделенные из лимфоцитов периферической венозной крови обследуемых индивидов методом фенольно-хлороформной экстракции [6].

Изучение полиморфных локусов -308G>A гена TNFα, 309T>G гена MDM2, 609C>T гена NQO1 проводили методом полимеразной цепной реакции синтеза ДНК. Для генотипирования использовали локусспецифические олигонуклеотидные праймеры

TNFα-F 5' AATAGGTTTTGAGGGCCATG 3', TNFα-R 5' TCCTCCCTGCTCCGATTCCG 3', MDM2-F 5' CGCGGGAGTTCAGGGTAAAG 3', MDM2-R 5' CTGAGTCAACCTGCCCACTG 3', NQO1-F 5' TCCTCAGAGTGGCATTCTGC 3', NQO1-R 5' TCTCCTCATCCTGTACCTCT 3' и эндонуклеазы рестрикции: для TNFα – Bsp19I, для MDM2 – Msp A1I, для NQO1 – Hinf I.

Математическую обработку результатов исследования проводили на IBM-Pentium IV с использованием статистических программ BIOSTAT (Primer of Biostatistics, 4th Edition, S.A.Glantz, McGraw-Hill), а также в программах Statistica, Microsoft Excel.

Достоверность различий в распределении частот аллелей и генотипов между группами выявляли, сравнивая выборки с использованием критерия c2 с поправкой Иейтса. Статистически значимыми считали различия при p<0,05. Относительный риск заболевания по конкретному признаку вычисляли как отношение шансов, доверительный интервал для относительного риска.

Результаты и обсуждение

Читайте статью целиком
в печатной версии журнала
!

Содержание | Следующая статья | Предыдущая статья


Начата подписка на 2016 год!

Обновление на книжной полке: компакт-диск Цитокины и воспаление, 2008 год.

© 2002-2017 Цитокины и Воспаление