Научно-практический журнал
[О компании] Издательство 'Цитокины и воспаление' - Журнал 'Цитокины и Воспаление'

197376, Санкт-Петербург, ул. Акад. Павлова, д. 12,
Институт экспериментальной медицины РАМН
Тел.: (812) 543 52 14, +7 921 984 11 30, +7 921 909 55 49
Факс: (812) 543 52 14
E-mail:
Web: www.cytokines.ru


  


2016 год
1 номер 2 номер

О Журнале

Текущий год
Архив

Рубрики
Подписка

NEW Книжная полка
NEW Стол заказов

Карта сайта
Правила для авторов

Поиск

Контакты
Наши партнеры:

Русский языкEnglish language
Карта сайта Написать письмо, наши координаты

Содержание | Следующая статья | Предыдущая статья

Журнал 'Цитокины и воспаление', 2013, № 1

Заказать этот номер

Заказать эту статью в PDF

Оригинальные статьи

Номер 1'2013

Эндотоксин-нейтрализующее действие антимикробных пептидов

Г.М. Алешина, О.В. Шамова, С.В. Перекрест, И.А. Янкелевич, А.Ю. Семочкина, А.А. Колобов, Ю.В. Андреева, В.Н. Кокряков

Проведен скрининг антимикробных пептидов (дефенсинов, кателицидинов) с целью выявления соединений, сочетающих в себе эндотоксин-нейтрализующие и противовоспалительные свойства, и не вызывающих активацию синтеза активных форм кислорода. Установлено, что кателицидины из лейкоцитов свиньи (PR39, профенин-1, протегрин-1), бета-дефенсин черепахи TBD-1 и пептид из целомоцитов червя Arenicola marina ареницин-1 обладают высокой ЛПС-связывающей активностью в условиях in vitro. Показано, что дефенсин человека, протегрин-1, профенин-1, PR39 снижают уровень ЛПС-индуцированной экспрессии гена провоспалительного цитокина интерлейкина (IL)-1 мононуклеарами крови животных. Ареницин не влияет на экспрессию гена IL1B. Показано, что пептиды PR39 и протегрин-1 в условиях in vivo усиливают спонтанную продукцию супероксидного радикала клетками крови и повышают содержание продуктов перекисного окисления липидов (диеновых конъюгатов) как у интактных животных, так и у ЛПС-стимулированных, в то время как профенин-1 в условиях in vivo не изменяет уровень генерации супероксидного радикала клетками крови и содержания диеновых конъюгатов в плазме крови. Таким образом показано, что профенин-1 обладает оптимальным набором свойств для потенциального эндотоксин-нейтрализующего препарата: связывает ЛПС с высокой аффинностью, снижает ЛПС-индуцированную экспрессию провоспалительного цитокина IL-1β, не усиливает перекисное окисление. (Цитокины и воспаление. 2013. Т. 12. № 1. С. 72–77.)

Ключевые слова: антимикробные пептиды, эндотоксин, экспрессия цитокинов, продукция свободных радикалов.

Ведущим патогенетическим фактором, запускающим каскад реакций системного воспаления, является липополисахарид (ЛПС), или эндотоксин — компонент наружной мембраны грам-отрицательных бактерий. Через специализированные рецепторы на клетках иммунной системы и эндотелия сосудов (TLR4, CD14) эндотоксин инициирует продукцию провоспалительных цитокинов и активных форм кислорода, которые, наряду с защитным противомикробным действием, оказывают на организм и повреждающее воздействие, приводящее к системному нарушению гемодинамики и жизнедеятельности клеток и тканей. В связи с этим является актуальным вопрос о разработке профилактических и терапевтических медикаментозных средств, направленных на избирательное связывание и нейтрализацию эндотоксинов как ведущих патогенетических факторов эндотоксинового шока.

Естественными прототипами подобных соединений являются катионные антимикробные пептиды (дефенсины, бактенецины, профенины) и белки (бактерицидный проницаемость увеличивающий белок, лактоферрин), которые, наряду с проявлением антибиотической активности, могут связывать ЛПС с высокой аффинностью и обладать противовоспалительным действием [5, 13]. Существуют данные, указывающие на возможное участие антибиотических пептидов нейтрофильных гранулоцитов в регуляции синтеза и процессинга провоспалительных цитокинов [4, 10]. В то же время недостаточно изученным остается вопрос о влиянии антибиотических пептидов на синтез активных форм кислорода, которые являются патогенетическими факторами при развитии системного воспаления.

Целью настоящей работы стал скрининг антимикробных пептидов для выявления соединений, проявляющих эндотоксин-нейтрализующие, противовоспалительные свойства и не вызывающих активации синтеза активных форм кислорода, которые могли бы послужить основой для создания нового эндотоксин-нейтрализующего препарата.

Материалы и методы

Экспериментальные животные. Работа проведена на самцах крыс линии Wistar весом 200–250 г. Крыс содержали в пластиковых клетках по 6–10 животных при постоянной температуре (21±2 °С), 12-часовом световом дне и неограниченном доступе к воде и пище.

Получение антимикробных пептидов. Профенин-1, PR39 и протегрин-1 выделены из лейкоцитов свиньи, дефенсин НNP-1 — из лейкоцитов человека, дефенсин TBD-1 — из лейкоцитов черепахи по ранее описанным методикам, включающим кислотную экстракцию из клеток, разделение по молекулярной массе ультрафильтрацией на мембранах, разделение с помощью препаративного электрофореза и заключительную очистку методом высокоэффективной жидкостной хроматографии [6, 8, 9, 15]. Химически синтезированный ареницин-1 любезно предоставлен Т.В. Овчинниковой (ИБХ РАН).

Оценка ЛПС-связывающей активности пептидов. ЛПС-связывающую активность пептидов определяли с помощью набора количественного хромогенного Limulus amebocyte lysate-теста (LAL-теста) (QCL-1000 Limulus amebocyte lysate kit, «Lonza Walkersvile», USA) согласно протоколу, прилагаемому к набору. Тестируемые пептиды разводили в воде, свободной от пирогенов, и инкубировали с ЛПС в течение 1 ч при 37 °С.

Модель для испытания эндотоксин-нейтрализующего действия антимикробных пептидов. В качестве модели использовали введение животным эндотоксина, который вызывает экспрессию гена провоспалительного цитокина IL-1β. Подопытным крысам в хвостовую вену вводили раствор ЛПС E. coli («Sigma», серотип 055:В5), антимикробные пептиды или физиологический раствор. Антимикробные пептиды и ЛПС вводили из расчета 100 и 25 мкг/кг веса животного, соответственно. В случае совместного испытания антимикробные пептиды вводили через 10 мин после введения ЛПС. Через 1 ч после введения препаратов осуществляли забор крови. Фракцию мононуклеарных клеток крови выделяли по стандартной методике с помощью центрифугирования в градиенте фиколла–верографина. Оценку влияния антимикробных пептидов на экспрессию гена IL1B в мононуклеарных лейкоцитах лабораторных животных проводили методами обратной транскрипции и полимеразной цепной реакции (ПЦР) с помощью системы интерактивного анализа ПЦР (ПЦР в реальном времени).

Выделение РНК из клеток. Выделение РНК проводили с помощью коммерческого набора «Aurum Total RNA Mini Kit» фирмы «BioRad» (USA) по соответствующим протоколам.

Постановка полимеразной цепной реакции в режиме реального времени.

ПЦР ставили со специфическими праймерами к мРНК IL-1β, а также глицеральдегид-3-фосфатдегидрогеназы (ГАФД), используемой в качестве внутреннего контроля при постановке ПЦР.

Праймеры подбирали с использованием компьютерной программы Primer3, доступной в Интернете по адресу http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi (Primer3, WhiteheadInstituteforBiomedicalResearch, Cambridge). Синтез праймеров осуществляла фирма «Синтол» (Москва).

IL-1β: 5' tacctgtcctgtgtgatgaa 3' (прямой) и 5' gaggtgctgatgtaccagtt 3' (обратный),

ГАФД: 5' ccactcagaagactgtggat 3' (прямой) и 5' gtcatcatacttggcaggtt 3' (обратный).

Для оценки экспрессии генов методом ПЦР в режиме реального времени использовали набор «iScript One-Step RT-PCR Kit with SYBR Green» фирмы «BioRad» (USA), позволяющий проводить реакции обратной транскрипции и ПЦР в одной пробирке.

Применяли следующий температурный режим:

1) 94 °С — 4 мин; 2) 94 °С — 30 с; 3) 55 °С — 30 с; 4) 72 °С — 30 сек; шаги 2–4 повторяются в течение 40 циклов.

Специфичность продуктов реакции оценивали по кривым плавления.

Для постановки ПЦР в режиме реального времени использовали амплификатор «MiniOpticon» фирмы «Bio-Rad». Уровни экспрессии гена IL1B относительно экспрессии гена внутреннего контроля оценивали с помощью программы сравнения, встроенной в программное обеспечение прибора.

Тест с использованием нитросинего тетразолия. Исследование влияния антимикробных пептидов на уровень генерации супероксидного радикала клетками цельной крови крыс in vitro проводили с использованием теста с нитросиним тетразолием (НСТ-тест) в биохимической модификации [2].

Ход определения:

К 1 мл цитратной крови добавляли 1 мл забуференного (рН 7,2–7,4) физиологического раствора (ЗФР). К 0,5 мл разбавленной крови — 0,1 мл 2 мМ раствора НСТ и 0,1 мл раствора антимикробных пептидов (или ЗФР). Конечная концентрация антимикробных пептидов в пробе — 4 мкг/мл. Инкубирование проводили в течение 30 мин при 37 °С. Для удаления эритроцитов добавляли в пробирки по 10 мл Н2О, оставляли на 10 мин при комнатной температуре. Центрифугировали 15 мин при 2000 об./мин, надосадок сливали. Останавливали реакцию, заливая осадок 10 мл 0,1 н НCl. Центрифугировали 15 мин при 2000 об./мин. Промывали осадок 10 мл Н2О. К осадку приливали 3 мл диметилформамида и экстрагировали формазан на водяной бане при 100 °С 20–30 мин до полного растворения формазана. После остывания в пробирки добавляли 3 мл 10 н КОН (гидроксид калия), перемешивали и оставляли для разделения фракций. Измеряли оптическую плотность верхней фракции при длине волны 710 нм.

Рассчитывали показатель НСТ-редукции (П-нст) по формуле:

П-нст = ОП710 / Сф × В,

где ОП710 — оптическая плотность диметилформамидного экстракта,

Сф — количество фагоцитов в пробе,

В — время контакта с НСТ в секундах.

Для оценки оксидантных свойств антимикробных пептидов in vivo исследуемые препараты вводили животным либо индивидуально, либо совместно с ЛПС. Препараты пептидов предварительно обрабатывали полимиксин-агарозой для удаления возможных примесей ЛПС. Через час после введения производили забор крови и определяли степень спонтанной генерации супероксидных радикалов с помощью НСТ-теста, а также уровень диеновых конъюгатов в плазме крови, который указывает на интенсивность перекисного окисления липидов крови.

Определение уровня диеновых конъюгатов в плазме. Принцип метода основывается на установлении содержания первичных продуктов перекисного окисления липидов (ПОЛ) в крови по поглощению липидным экстрактом монохроматического светового потока в ультрафиолетовой области спектра (233 нм) [1].

Статистическая обработка результатов. Для статистической обработки использовали программу Statistica 6. Достоверность различий между группами оценивали с помощью критерия Манна — Уитни. Данные представлены в виде средних значений ± ошибка среднего. Различия считали достоверными при р<0,05.

Результаты и обсуждение

Читайте статью целиком
в печатной версии журнала
!

Содержание | Следующая статья | Предыдущая статья


Начата подписка на 2016 год!

Обновление на книжной полке: компакт-диск Цитокины и воспаление, 2008 год.

© 2002-2017 Цитокины и Воспаление