Научно-практический журнал
[О компании] Издательство 'Цитокины и воспаление' - Журнал 'Цитокины и Воспаление'

197376, Санкт-Петербург, ул. Акад. Павлова, д. 12,
Институт экспериментальной медицины РАМН
Тел.: (812) 543 52 14, +7 921 984 11 30, +7 921 909 55 49
Факс: (812) 543 52 14
Web: www.cytokines.ru


2016 год
1 номер

О Журнале

Текущий год


NEW Книжная полка
NEW Стол заказов

Карта сайта
Правила для авторов


Наши партнеры:

Русский языкEnglish language
Карта сайта Написать письмо, наши координаты

Содержание | Следующая статья | Предыдущая статья

Журнал 'Цитокины и воспаление', 2013, № 3

Заказать этот номер

Заказать эту статью в PDF

Оригинальные статьи

Номер 3'2013

Препараты рекомбинантных альфа/бета-интерферонов вызывают феномен супериндукции генов «домашнего хозяйства» в клетках НСТ-116 (аденокарциномы толстого кишечника)

Т.М. Соколова, А.Н. Шувалов, И.М. Шаповал, З.А. Соколова, Ф.И. Ершов

Целью исследования был сравнительный анализ механизма действия рекомбинантных препаратов IFNa2 (Реаферон) и IFNb1 (Авонекс) на экспрессию 4-х генов «домашнего хозяйства» и генов 3-х типов IFN в опухолевых клетках НСТ-116 и фибробластах эмбриона человека (ФЭЧ). В клетках НСТ-116 (аденокарцинома толстого кишечника) препараты рекомбинантных IFNa2 и IFNb1 вызывали супериндукцию генов 18S рибосомальной РНК (рРНК), β2-микроглобулина, глицеральдегид-3-фосфатдегидрогеназы (ГАФД) и β-актина. Результаты, полученные количественным методом ОТ-ПЦР в режиме реального времени, впервые показывают, что эти известные референс-гены, широко используемые для нормализации экспрессии индуцибельных генов, сами являются IFN-зависимыми в опухолевых клетках. Активация генов семейства IFNa и IFNl1 в опухолевых клетках была слабой, а транскрипция генов IFNb1 и IFNg — невыявляемой. В эмбриональных фибробластах препараты рекомбинантных IFN сильно активировали ген IFNb1, но стимуляция «хозяйских генов» была менее выраженной. Обнаруженная высокая IFN-зависимость генов «домашнего хозяйства» в опухолевых клетках рассматривается как новый противоопухолевый механизм действия IFN, направленный на восстановление нарушенных процессов клеточного метаболизма. (Цитокины и воспаление. 2013. Т. 12. № 3. С. 52–56.)

Ключевые слова: рекомбинантные препараты интерферонов, гены «домашнего хозяйства», супериндукция, опухолевые клетки НСТ-116 и человеческие эмбриональные фибробласты.

Известно, что интерфероны (IFN) вызывают индукцию нескольких сотен клеточных генов, среди которых наиболее IFN-зависимыми являются гены системы IFN [2]. Под влиянием IFN происходят существенные изменения в общем метаболизме клеток, затрагивающие клеточный цикл и апоптоз, липидный обмен и митохондриальное дыхание [6, 14]. Поэтому мы исследовали действие IFN на экспрессию генов «домашнего хозяйства», мРНК которых во многих исследованиях с применением ОТ-ПЦР используются как референсные. С целью выбора стабильного референса сделан анализ уровней экспрессии большой группы генов «домашнего хозяйства» в различных типах клеток, в т. ч. опухолевых и гормонально-зависимых [13, 18]. Эффекты медицинских препаратов IFN на экспрессию генов «домашнего хозяйства» в опухолевых клетках не изучены. Имеется одно сообщение (Vazquez-Blomquist D., 2012) о клетках глиобластомы человека U87MG о том, что рекомбинантные IFNa и IFNg изменяют стабильность экспрессии семи референс-генов. Экспрессия трех из них: 18S рибосомальной РНК (рРНК), β2-микроглобулина (β2М) и глицеральдегид-3-фосфат-дегидрогеназы (ГАФД) также исследована нами в двух типах человеческих клеток (опухолевых и нормальных), обработанных препаратами рекомбинантных IFNa2 и IFNb1 [17].

В опухолевых клетках регуляция экспрессии многих клеточных генов претерпевает существенные изменения вследствие нарушений процессов сигнальной трансдукции, активации онкогенов и появления мутаций в генах-регуляторах [5, 9]. Прежде всего это относится к регуляции экспрессии группы генов врожденного иммунитета. Среди них ключевая роль принадлежит генам трех типов IFN (a/b — I тип, g — II тип и l — III тип). Интерфероновые гены являются взаиморегулируемыми на уровне транскрипции, но в опухолевых клетках их индукция снижена или подавлена. Согласно данным литературы, линия клеток НСТ-116 (аденокарцинома толстого кишечника) является малочувствительной к IFN [7]. Наоборот, линия клеток ФЛЭЧ-977 (фибробласты легкого эмбриона человека) имеет высокую чувствительность к препаратам IFN и дсРНК [3]. Цель настоящего исследования — сравнить транскрипционные эффекты известных препаратов IFN (Реаферон и Авонекс) на гены «домашнего хозяйства» и интерфероновые гены в нормальных и опухолевых клетках человека. В спектре IFN-индуцируемых клеточных генов нами обнаружены референс-гены «домашнего хозяйства». Феномен супериндукции «хозяйских» генов, вызываемый IFN в опухолевых клетках НСТ-116, рассматривается как возможный противоопухолевый механизм, направленный на нормализацию метаболических нарушений.

Материалы и методы

Клеткиаденокарциномы толстого кишечника (НСТ-116) получены из РОНЦ им. Н.Н. Блохина (ATCC catalog No. CCL.-247).Фибробласты легкого эмбриона человека (ФЛЭЧ-977) — из Медико-генетического центра РАМН (г. Москва). Постановку экспериментов осуществляли в 96-луночных плато («Costar») на монослое клеток, выращенном в питательной среде RPMI-1640 (клетки HCT-116) и DMEM (клетки ФЛЭЧ) с добавлением глутамина, 10 % сыворотки телят и гентамицина (НПФ«Панэко», г. Москва).

Препараты человеческих рекомбинантных ИФН

Реаферон — рекомбинантный IFNa2b («Вектор», Новосибирск), выпускаемый в ампулах с активностью 1 млн МЕ; Авонекс — IFNb1a, 30 мкг, 6 млн МЕ («Биоген Айдек БВ», Нидерланды); рекомбинантный IFNa2a, 108 МЕ/мл («ООО «Протеиновый контур», Санкт-Петербург ). Исследуемые препараты IFN вносили в питательную среду в дозе 500, 1000, 10000 и 100000 МЕ/мл на срок 24 ч при 37 °С. Контролем были клетки, необработанные IFN. Каждый вариант повторяли в 8 лунках плато, после инкубации среду с IFN удаляли, клетки отмывали свежей средой и затем объединяли в одну пробу для выделения РНК. В клетках ФЛЭЧ-977 все препараты рекомбинантных IFN имели высокую антивирусную активность, соответствующую заявленной производителями.

Выделение РНК и получение суммарной кДНК в реакции обратной транскрипции. Клетки (~1 млн) лизировали в реагенте TRIzol®LS (Life technologies (Invitrogen)) согласно инструкции. Выделенные РНК обрабатывали препаратом ДНК-азы (DNA-free™ Kit (Invitrogen™).

Реакция обратной транскрипции (объем 20 мкл) включала 1 мМ 4-х видов дНТФ, 200 ЕД фермента RT MMuLV, 20 ЕД RNAsin, 2 мкл «random» праймеров с концентрацией 1,5 ое/мл. Полученные кДНК разводили в 5 и 50 раз и анализировали в количественной ПЦР.

ПЦР в режиме реального времениосуществляли на приборе CFX-96 («Bio-Rad») с парами специфических олигонуклеотидных праймеров, описанных в литературе для референс-генов 18S рРНК, β2М и β-актина [13] и ГАФД [8]. Использована ранее проверенная в исследованиях [1, 3] пара праймеров к консервативным участкам генов IFNa (подтипы 4, 7, 8.17 и 21). В программе «Primer Express» вновь рассчитаны праймеры к мРНК IFNb1 (прямой — 5¢atgaccaacaagtgtctc и обратный — 5¢tcagtttcggaggtaacc) и мРНК IFNl1 (прямой — 5¢catcatcttggattgcccattt и обратный — 5¢tatttgaggtctcgctgtagg). Все праймеры были синтезированы фирмой «Синтол» (Россия). ПЦР в режиме реального времени поставлена с разведениями кДНК 1/5 и 1/50, смесью прямого и обратного праймеров 1,5 ОЕ/мл и 2-кратной смесью EvaGreen SuperMix («Bio-Rad») в объеме 20 мкл. Программа амплификации: активация 96 °С 2 мин, далее 40 циклов в режиме реального времени 94 °С 10 с, 55 °С 20 с и 72 °С 30 с. В конечной точке амплификации в программе плавления ДНК дана оценка специфичности образуемых ПЦР-продуктов (пики плавления CFX-96 65-95°С и ЭФ-подвижность ДНК-амплификатов в агарозном геле соответствовала расчетным размерам (рис. 1). Уровни генной экспрессии дельтаСq рассчитаны в программе «Gene Expression Analysis» CFX-96 относительно контроля=1.Статистически значимые различия в оценены при значениях дельтаСq >2 . Стандартные отклонения (SD) в повторных образцах представлены на рис. 2 и 3. Cравниваемые группы достоверно различаются с вероятностью более 95 %.

Результаты и обсуждение

Читайте статью целиком
в печатной версии журнала

Содержание | Следующая статья | Предыдущая статья

Начата подписка на 2016 год!

Обновление на книжной полке: компакт-диск Цитокины и воспаление, 2008 год.

© 2002-2017 Цитокины и Воспаление