Научно-практический журнал
[О компании] Издательство 'Цитокины и воспаление' - Журнал 'Цитокины и Воспаление'

197376, Санкт-Петербург, ул. Акад. Павлова, д. 12,
Институт экспериментальной медицины РАМН
Тел.: (812) 543 52 14, +7 921 984 11 30, +7 921 909 55 49
Факс: (812) 543 52 14
Web: www.cytokines.ru


2016 год
1 номер 2 номер

О Журнале

Текущий год


NEW Книжная полка
NEW Стол заказов

Карта сайта
Правила для авторов


Наши партнеры:

Русский языкEnglish language
Карта сайта Написать письмо, наши координаты

Содержание | Предыдущая статья

Журнал 'Цитокины и воспаление', 2014, № 2

Заказать этот номер

Заказать эту статью в PDF

Оригинальные статьи

Номер 2'2014

Экспрессия генов β-дефенсинов-1 и -2 и кателицидина LL-37 в слизистой дыхательных путей Оценка экспрессии генов бета-дефенсинов-1 и -2 человека и кателицидина LL-37 в слизистой оболочке верхних дыхательных путей

Е.В. Тырнова, Г.М. Алешина, Ю.К. Янов, В.Н. Кокряков

Цель работы: оценить экспрессию генов hBD-1, hBD-2 и LL-37 в поверхностном эпителии слизистой оболочки верхних дыхательных путей. Исследовали 210 образцов операционного материала: слизистую оболочку носа и верхнечелюстных пазух (нижние носовые раковины, слизистая среднего носового хода, полипы), аденоиды, небные миндалины, слизистую оболочку полости среднего уха и гортани. Оценку экспрессии генов hBD-1, hBD-2, LL-37 и бета-актина по уровню синтеза соответствующих мРНК проводили методом обратной транскрипции и ПЦР в режиме реального времени. Экспрессия гена hBD-1 установлена во всех образцах эпителия верхних дыхательных путей. Экспрессия гена hBD-2 детектирована во всех образцах небных миндалин, аденоидов, фиброзно-сосудистых полипов гортани, большинстве образцов слизистой среднего уха при холестеатоме. Экспрессия гена LL-37 детектирована во всех видах исследованных тканей, но в слизистой оболочке верхнечелюстных пазух, гортани, барабанной полости она отсутствовала в 14–47 % случаев. Экспрессия генов антимикробных пептидов в слизистой оболочке верхних дыхательных путей отражает разные потребности различных анатомо-функциональных областей в реализации иммунной защиты в рамках одной системы слизистых оболочек (полость носа, носоглотка, среднее ухо, гортань). (Цитокины и воспаление. 2014. Т. 13. № 2. С. 89–95.)

Ключевые слова: слизистая оболочка верхних дыхательных путей, бета-дефенсин-1 человека, бета-дефенсин-2 человека, кателицидин LL-37, полимеразная цепная реакция в режиме реального времени.


В секретах слизистых оболочек имеется множество молекулярных факторов, участвующих в реализации врожденного иммунитета как «первая линия защиты» их поверхности от инфекции. Существует мнение, что изменения в респираторном эпителии при хронических и рецидивирующих инфекциях играют ведущую роль в патогенезе заболеваний верхних дыхательных путей. Эпителий дыхательных путей – основная защитная система респираторного тракта. Компоненты оболочек бактериальных клеток (липополисахариды, липотейхоевые кислоты) могут повреждать функцию мукоцилиарногоклиренса дыхательного эпителия [13]. Рецидивирующие бактериальные и грибковые инфекции являются существенным фактором патогенеза хронического воспаления при заболеваниях верхних дыхательных путей.

Предпосылкой для нормального функционирования защитных систем верхних дыхательных путей, в особенности при постоянной угрозе вдыхания потенциально вредных микроорганизмов, является целостность носоглоточного эпителиального барьера. Важную роль в поддержании барьерной функции респираторного эпителия играют эндогенные антибиотические пептиды [1], в частности, дефенсины и кателицидин LL-37, обладающие широким спектром антимикробного действия. Антимикробные пептиды – это эффекторные молекулы врожденного иммунитета с прямой антимикробной и медиаторной функциями, обеспечивающие реализацию неотложных защитных реакций организма [1, 3]. Наряду с этим антимикробные пептиды способны мобилизовать различные типы фагоцитирующих лейкоцитов (нейтрофилов, моноцитов), незрелых дендритных клеток и лимфоцитов, а также стимулировать выработку IL-8 и инициировать дегрануляцию тучных клеток [15]. Они оказывают влияние на такие процессы, как пролиферация, индукция иммунитета, заживление ран, освобождение цитокинов, хемотаксис, протеазо–антипротеазный баланс и окислительно-восстановительный гомеостаз [3, 9]. Все эти данные свидетельствуют о широком функциональном потенциале антимикробных пептидов, реализуемом в различных реакциях противомикробной защиты на уровне слизистой оболочки верхних дыхательных путей.

Целью настоящей работы явилось изучение молекулярно-генетических основ активации элиминационных механизмов врожденного иммунитета путем исследования экспрессии генов антибиотических пептидов эпителиального барьера бета-дефенсина-1 человека (hBD-1), бета-дефенсина-2 человека (hBD-2), кателицидина LL-37.

Материалы и методы

Операционный материал от больных хроническими воспалительными заболеваниями верхних дыхательных путей, полученный во время планового хирургического вмешательства в условиях общей анестезии (табл. 1), немедленно помещали в стабилизирующий раствор RNAlater (Ambion) в соотношении 1:5 и сохраняли при температуре -20 °С до проведения молекулярно-генетических исследований.

Исследовано 210 образцов ткани от 201 больного. Образцы разделены на 18 групп в зависимости от анатомической зоны и диагноза (табл. 1). В качестве контрольной ткани служили нижние носовые раковины больных с искривлением перегородки носа, обычно используемые с этой целью. Вторым контролем служили образцы здоровой ткани слизистой оболочки среднего носового хода, полученные попутно в ходе операций. Хирургическое лечение было проведено больным в период вне обострения заболевания.

Общую РНК выделяли согласно протоколу Gen Elute Mammalian Total RNA Miniprep Kit и On-Column DNase I Digestion Set (Sigma-Aldrich) из поверхностного эпителия исследуемых образцов ткани. Синтез первой цепи кДНК проводили с использованием обратной транскриптазы M-MLV (Promega) в присутствии oligo(dT) и dNTPs (Медиген). Амплификацию проводили с использованием специфических праймеров [4, 11] и реактивов iQTM SYBR Green Supermix методом ПЦР с детекцией накопления продуктов реакции в режиме реального времени с помощью системы детекции продуктов ПЦР в реальном времени CFX96 Touch™ и программного обеспечения CFX Manager™ версия 2.1. Режим проведения реакции амплификации для hBD-1 и hBD-2: 4 мин при t=95 ºС, 15 с при t=94 ºС, 25 с при t=54 ºС, 25 с при t=72 ºС, 45 циклов. Режим проведения реакции амплификации для LL-37: 5 мин при t=95 ºС, 10 с при t=95 ºС, 1 мин при t=60 ºС, 40 циклов. В трети случаев из общей РНК с использованием специфических праймеров [11] и реактивов iScript™ One-Step RT-PCR Kit With SYBR® Green проведена совмещенная (одностадийная) обратная транскрипция и ПЦР с детекцией накопления продуктов реакции в режиме реального времени (синтез кДНК и амплификация выполняются в одной пробирке) с использованием того же оборудования. Режим проведения реакции амплификации: 10 мин при t=50 ºС, 5 мин при t=95 ºС, 10 с при t=95 ºС, 1 мин при t=60 ºС, 40 циклов. Уровень экспрессии мРНК стандартизировали относительно экспрессии гена бета-актина человека – одного из генов белков домашнего хозяйства (табл. 2). Относительную экспрессию генов рассчитывали как 2-ΔCт, где дельта CT – разность пороговых циклов целевого гена и гена бета-актина человека и оценивали в условных единицах.

Последовательности праймеров, использованных для ПЦР амплификации: hBD-1: 5' tgctgtttactctctgcttacttttgt 3' (прямой) и 5' ccaaggcctgtgagaaagttacc 3' (обратный); hBD-2: 5´ tgatgcctcttccaggtgttt 3' (прямой) и 5´ ggatgacatatggctccactctt 3' (обратный); LL-37: 5´ tcaccagaggattgtgacttcaa 3' (прямой) и 5´ tgagggtcactgtccccatac 3' (обратный); бета-актин человека: 5' gggtcagaaggattcctatg 3' (прямой) и 5' ggtctcaaacatgatctggg 3' (обратный).

Статистическую обработку данных проводили с помощью программы Prism 5 (GraphPad, Inc) методами описательной статистики с использованием непараметрических критериев различия (тест Манна – Уитни). Значения p<0,05 рассматривали как статистически значимые.

Результаты и обсуждение

Читайте статью целиком
в печатной версии журнала

Содержание | Предыдущая статья

Начата подписка на 2016 год!

Обновление на книжной полке: компакт-диск Цитокины и воспаление, 2008 год.

© 2002-2017 Цитокины и Воспаление