Научно-практический журнал
[О компании] Издательство 'Цитокины и воспаление' - Журнал 'Цитокины и Воспаление'

197376, Санкт-Петербург, ул. Акад. Павлова, д. 12,
Институт экспериментальной медицины РАМН
Тел.: (812) 543 52 14, +7 921 984 11 30, +7 921 909 55 49
Факс: (812) 543 52 14
E-mail:
Web: www.cytokines.ru


  


2016 год
1 номер 2 номер

О Журнале

Текущий год
Архив

Рубрики
Подписка

NEW Книжная полка
NEW Стол заказов

Карта сайта
Правила для авторов

Поиск

Контакты
Наши партнеры:

Русский языкEnglish language
Карта сайта Написать письмо, наши координаты

Содержание | Следующая статья | Предыдущая статья

Журнал 'Цитокины и воспаление', 2016, № 2

Заказать этот номер

Заказать эту статью в PDF

Оригинальные статьи

Номер 2'2016

Действие митогенов на дифференцировку клеток ТНР-1 и экспрессию TLR/RLR-генов

В.В. Полосков, З.А. Соколова, О.С. Бурова, А.Н. Шувалов, Т.М. Соколова

Изучено действие комплекса митогенов: фитогемаглютинин (ФГА) + конканавалин (КонА) + липополисахарид (ЛПС) на дифференцировку и экспрессию TLR/RLR-генов в клеточной линии острого моноцитарного лейкоза ТНР-1. Обработка митогенами и ЛПС (агонистом CD/TLR4) вызывала прикрепление и дифференцировку части клеточной популяции в макрофагоподобные клетки с адгезивными свойствами и иммунофенотипом СD11b, снижением уровней экспрессии миелоидных супрессоров CD33 и CD38, стимуляцией экспрессии группы генов рецепторов врожденного иммунитета TLR2, ТLR3, TLR8, MDA5 и фактора STAT1b. Результаты дают основание полагать, что описанная сочетанная комбинация митогенов с TLR-агонистом возможно будет полезной для получения чувствительной модели ТНР-макрофагов. (Цитокины и воспаление. 2016. Т. 15. № 2. С. 161–165.)

Ключевые слова: клеточная линия ТНР-1, дифференцировка в макрофагоподобные, ФГА, КонА, ЛПС, TLR-гены.

Толл-подобные рецепторы (TLRs) являются ключевыми регуляторами гематопоэза и активаторами лейкоцитов [4, 14]. Линии клеток миелоидного лейкоза имеют характерные изменения в иммунных ответах, обусловленные уровнями их дифференцировки. Проводится активный поиск дополнительных активаторов дифференцировки миелоидных клеток среди митогенов и TLR-агонистов.

В настоящей работе для этих целей в клетках острого моноцитарного лейкоза ТНР-1 апробирован комплекс фитогемагглютинин (ФГА) + конканавалин А (КонА) + агонист TLR4 – липополисахарид (ЛПС). Каждый из этих митогенов имеет характерные особенности иммуномодулирующего действия. Так, ФГА (растительный гликопротеин) — стимулятор Т-клеточной пролиферации, используется как индуктор интерлейкинов IL-2 и IL-5, гранулоцит-макрофаг колониестимулирующего фактора (GM-CSF) и интерферона (IFN) g в клетках крови [18]. В макрофагах ФГА активирует сигнальные тирозиновые и митоген-зависимые киназы и вызывает образование IL-1b и TNFa [11]. КонА (бобовый лектин) — поликлональный активатор лимфоцитов, подобно ФГА активирует сигнальные тирозиновые киназы, взаимодействует с сиаловыми рецепторами, содержащими маннозу или глюкозу [13]. Дополнительно, в опухолевых клетках КонА – индуктор митохондриального апоптоза [12]. ЛПС — эндотоксин, выделенный из внешней мембраны грамнегативных бактерий, индуктор многих воспалительных цитокинов в моноцитах человека. Взаимодействуя с клеточным рецептором CD14 и сигнальным рецепторным комплексом TLR4/MD2, ЛПС стимулирует несколько сигнальных путей с участием NF-kB и митогеновых протеинкиназ ERK, JNK и p38 [7].

Ранее в клетках крови человека нами была показана активация препаратом IFN типа 1 (Реаферон), двуспиральной РНК дрожжей (Ридостин) и растительным пептидогликаном (Иммуномакс) экспрессии генов TLR/RLR-рецепторов и транскрипционных факторов сигнальных каскадов, приводящих к синтезу провоспалительных цитокинов [1– 3].

Настоящие исследования проведены на клетках острого моноцитарного лейкоза человека THP-1, которые под действием форбол-12-миристат-13-ацетата (PMA) приобретают адгезивные свойства и дифференцируются в макрофагоподобные [5, 6].

Исходя из возможных механизмов действия на моноциты и клетки крови реагентов из набора митогенов «Цитокин-стимул-бест», мы оценили влияние митогенного препарата на адгезивные свойства и иммунофенотип клеток ТНР-1. Мы предполагали, что митогены будут стимулировать экспрессию генов ТLR/RLR-рецепторов и сигнальных транcдукторов и активаторов транскрипции STAT1A, STAT1B и STAT2 и что эти процессы будут ассоциированы с дифференцировкой моноцитов в макрофаги [10]. Полученная клеточная модель ТНР-Митоген может стать альтернативой макрофагоподобной чувствительной модели ТНР-РМА, широко используемой для оценки иммуномодулирующих препаратов [8, 17].

Материалы и методы

Перевиваемая суспензионная культура клеток THP-1, выделенная от ребенка с острым моноцитарным лейкозом (АТСС-TIB-202), была получена из ФГБНУ «РОНЦ им. Н.Н. Блохина» Минздрава России. Определение жизнеспособных клеток и их количество проводили автоматическим счетчиком клеток «BioRad TC-20» с использованием красителя трипановый синий. Пересев клеток осуществляли в концентрации 5´105/мл в культуральных флаконах объемом 25 см2 с питательной средой RPMI-1640, содержащей глютамин (ООО «Компания «ПанЭко»), 10 % сыворотки эмбрионов коров («HyClone») и антибиотик гентамицин (ООО «Компания «ПанЭко»),).

Микроскопическое исследование клеток ТНР-1 (до и после обработки комплексом митогенов) проводили в инвертированном световом микроскопе «DMIL» («Leica Microsystems», Германия) при увеличении ´400. Микрофотосъемку выполняли с помощью оборудования «Nicon digital camera DXM1200F».

Митогены ЛПС 2 мкг, ФГА и КонА взяты из набора «Цитокин-Стимул-Бест»(АО «Вектор-Бест», Россия) и растворены в стерильной питательной среде DMEM согласно инструкции. Обработку клеток ТНР-1 комплексом митогенов делали в течение 120 ч при 37°С в атмосфере 5 % СО2 и влажности 70 % (среда DМЕМ с 10 % сыворотки эмбрионов коров и антибиотиком гентамицин). Параллельно исследовали нестимулированные клетки (контроль).

Проточно-цитофлуориметрический анализклеток ТНР-1 (контроль и опыт с митогенами) с меченными FITC и PE моноклональными антителами к CD33, CD38, CD11b и HLA-DR («BD Bioscience») выполняли по стандартной методике на приборе «FACSCantoII» («Becton Dickinson»)

Экспрессия генов методом ОТ-ПЦРв реальном времени. Исследовали клетки, прикрепившиеся к пластику и оставшиеся в суспензии. Две клеточные популяции лизировали буфером «PureZOL» («BIO-RAD Laboratories»). Выделение суммарной РНК и обработку ДНКазой (набор «DNA-free», «Ambion») проводили согласно инструкциям. В реакции обратной транскрипции (ОТ) с праймерами олиго(dT)15 или random (случайные) получали кДНК. Использовали реактивы: фермент обратную транскриптазу MMuLV, ингибитор РНК-азы RNAsin, 4 вида дезоксинуклеотидтрифосфатов дАТФ, дГТФ, дЦТФ, дТТФ (фирма «Promega», США). В количественной ПЦР анализировали кДНК в разведении 1/5. Добавляли пары специфических праймеров и 2-кратную смесь SsoFast EvaGreen Supermix («BIO-RAD Laboratories Inc.», США). Структура праймеров на гены рецепторов TLR3, TLR4, TLR7, TLR8, TLR9, RIG1 MDA5 и фактор TNFa опубликована нами ранее [1– 3]. Дополнительно в программе «Primer 3 Blast» были рассчитаны пары праймеров к мРНК TLR2: прямой 5¢-tgcctggccctctctacaaa и обратный 5¢-gtgtcttgggaatgcagcct; Stat1A: прямой 5¢-gggaccttcctgctgcggttc и обратный 5¢-tcaggagacatggggagcaggtt; Stat1B: прямой 5¢ –ggctggggcctgttgaagat и обратный 5¢-tgataggcagtaacacgggga; Stat2: прямой 5¢-cggaaattctgccgggacat и обратный 5¢-ggctctccacaggtgtttcg.

ПЦР ставили на приборе CFX-96 («BIO-RAD Laboratories», США) в режиме реального времени. Протокол ПЦР: 96 °С 2 мин, далее 55 циклов 94 °С 10 сек, 50–54 оС 20 сек, 72 °С 30 сек. Пороговые циклы (Cq) логарифмической фазы синтеза регистрировали по нарастанию флуоресцентного сигнала красителя EvaGreen, интеркалирующего в ДНК. Анализ относительной (дельтаСq) и нормализованной (2дельтаCq) экспрессии генов проводили в контрольных и опытных пробах с митогенами («монослой» и «взвесь») с помощью программы «Date analysis CFX-96». Уровни экспрессии в контрольных ТНР-1 клетках (без митогенов) принимали равным 1. В качестве референс-гена использовали 18S рибосомальную РНК. В конечной точке ПЦР по температурным пикам плавления ДНК-амплификатов устанавливали специфичность. Дополнительно, полученные ПЦР-продукты анализировали электрофорезом в агарозном геле по размерам в сравнении с ДНК-маркерами (набор «DNA-ladder», «Promega»).

Результаты и обсуждение

Читайте статью целиком
в печатной версии журнала
!

Содержание | Следующая статья | Предыдущая статья


Начата подписка на 2016 год!

Обновление на книжной полке: компакт-диск Цитокины и воспаление, 2008 год.

© 2002-2017 Цитокины и Воспаление