Научно-практический журнал
[О компании] Издательство 'Цитокины и воспаление' - Журнал 'Цитокины и Воспаление'

197376, Санкт-Петербург, ул. Акад. Павлова, д. 12,
Институт экспериментальной медицины РАМН
Тел.: (812) 543 52 14, +7 921 984 11 30, +7 921 909 55 49
Факс: (812) 543 52 14
E-mail:
Web: cytokines.ru


  


2017 год
1 номер 2 номер
3 номер

О Журнале

Текущий год
Архив

Рубрики
Подписка

NEW Книжная полка
NEW Стол заказов

Карта сайта
Правила для авторов

Поиск

Контакты
Наши партнеры:

https://pornoseksxxx.com/

Русский языкEnglish language
Карта сайта Написать письмо, наши координаты

Содержание | Следующая статья | Предыдущая статья

Журнал 'Цитокины и воспаление', 2008, № 1

Подписаться на 2018 год

Заказать этот номер

Заказать эту статью в PDF

Оригинальные статьи

Номер 1'2008

ИЗМЕНЕНИЕ РЕГУЛЯТОРНЫХ ФУНКЦИЙ ДЕНДРИТНЫХ КЛЕТОК ПОСЛЕ ТРАНСФЕКЦИИ SIRNA IL?12P35

Т.Е. Иком, И.А. Попов, Е.К. Олейник

Изучали последствия индукции РНК-интерференции (RNAi) в дендритных клетках (ДК) костного мозга мышей с использованием коротких интерферирующих двунитевых РНК (siRNA), специфичных к гену IL?12p35. Трансфекция siRNA IL?12p35 приводит к снижению продукции биоактивного IL?12p70 и значительным изменениям регуляторных функций ДК: усилению продукции IL?10 и снижению способности ДК стимулировать аллогенные Т-клетки в смешанной культуре лимфоцитов. При использовании ДК с выключенным геном IL?12 для стимуляции аллогенных Т-клеток наблюдается переключение иммунного ответа Th1?"?Th2, что проявляется в снижении экспрессии гена IFN? и увеличении продукции IL?4. Таким образом, введение siRNA IL?12p35 в ДК является эффективным способом индукции иммунной модуляции, причем основной механизм заключается в изменении профиля секретируемых цитокинов, в частности, усилении продукции IL?10. Данный способ изменения функций ДК может быть использован в разработке генетических методов терапии широкого круга заболеваний. (Цитокины и воспаление. 2008. Т. 7, № 1. С. 29-34.)

В последние годы становится ясным, что дендритные клетки (ДК) являются главными регуляторами иммунного ответа. ДК оказывают прямое или непрямое воздействие на стимуляцию или подавление функций Т-клеток, В-клеток, NK, NKT [10, 12]. Среди всех антиген-презентирующих клеток ДК считаются наиболее мощными активаторами Т-клеток, и обладают уникальной способностью к поляризации иммунного ответа в сторону Th1 или Th2. Th1 характеризуются высоким уровнем секреции INF? и IL?2, в то время как Th2 отличаются высоким уровнем секреции IL?4 и IL?13. Известно, что при различных заболеваниях человека происходит подобная поляризация иммунного ответа. Поэтому интерес к изучению регуляторных свойств ДК возрастает.

ДК способны несколькими путями активировать Т-клетки: они передают сигнал об антигене с помощью молекул MHC, вырабатывают костимуляторный сигнал, который ассоциируется с такими мембраносвязанными молекулами, как CD40, CD80/86 и OX40L [13], а также продуцируют растворимые цитокины, которые индуцируют Т-клеточную дифференцировку в Th1-фенотип (IL?12) или Th2-фенотип (IL?10) [11]. Когда любой из этих трех сигналов ингибируется, Т-клетки могут подвергаться апоптозу, анергии, Th2-сдвигу или дифференцироваться в Т-регуляторные клетки (Treg). Показано, что ДК играют ключевую роль в поддержке аутотолерантности, а также, возможно, в формировании иммуносупрессии при опухолевом росте посредством генерирования Т-регуляторных супрессорных лимфоцитов CD4?+?CD25?+?[1, 3].

Между субпопуляциями ДК, которые стимулируют или супрессируют иммунный ответ, существуют различия в экспрессии цитокинов, а также костимуляторных молекул. Экспрессия IL?12, по-видимому, стимулирует активацию Th1, в то время как продукция IL?10 стимулирует активацию Th2, а также генерацию Treg [14]. Из этого следует, что ДК могут быть использованы в иммунотерапии для усиления Т-клеточного ответа (в случае развития опухолей) или для его снижения (при аутоиммунных расстройствах, при трансплантации органов). В связи с этим ДК представляют собой очень привлекательный объект для индукции иммунной модуляции с целью разработки целенаправленных методов иммунотерапии.

Одним из наиболее перспективных методов селективного выключения генов является индукция РНК-интерференции (RNA-interference - RNAi). Известно, что RNAi - это эндогенный клеточный механизм защиты против репликации вирусов [8]. При распознавании двунитевыми РНК (dsRNA) проникающих в клетку "опасностей" происходит деградация любых мРНК-транскриптов, гомологичных этим dsRNA. В ряде работ было показано, что даже очень короткие последовательности РНК длиной в 21-23 нуклеотида (small interfering RNA - siRNA) могут вызвать полную супрессию IFN-ответа и привести к деградации близких мРНК [2, 5]. Этот процесс оказался чрезвычайно специфичным, т. к. даже одна единственная замена в 21-нуклеотидной последовательности практически отменяла все эффекты siRNA. Также показано, что siRNA включаются в энзиматический комплекс, который проводит множество повторяющихся циклов деградации мРНК-мишени, что обеспечивает высокую эффективность RNAi [15]. Таким образом, RNAi представляет собой мощный способ ингибирования эндогенной экспрессии генов и, следовательно, может быть средством эффективной модуляции иммунного ответа.

Искусственная индукция RNAi может быть использована в терапевтических целях для выключения определенных, например, патологических генов. Поскольку RNAi - это природный механизм защиты, то можно предположить, что индукция генетических изменений манипулированием этого явления представляет собой биологически более подходящий способ интервенции в организм и воздействия на него, чем применение антисмысловых последовательностей или химических ингибиторов, которые имеют свойство неспецифически подавлять не только гены-мишени, но и другие гены.

Целью работы было изучение функциональных и фенотипических свойств генетически модифицированных ДК после трансфекции последовательностями siRNA, специфичными для p35 субъединицы IL?12 (siRNA IL?12p35).

Материалы и методы

Животные. Самки мышей C57BL/6 и BALB/c (The Jackson Laboratories, Bar Harbor, USA), 5-недельного возраста.

Выделение ДК из костного мозга. ДК были получены из костномозговых клеток-предшественников описанным ранее способом [5]. Клетки костного мозга вымывали из бедренных и большеберцовых костей мышей линии C57Bl/6, отмывали и вносили для культивирования в 6-луночные платы в концентрации 4???106 клеток на лунку в 4 мл полной среды (RPMI?1640 дополняли 2 мM l-глутамина, 100 ЕД/мл пенициллина, 100 мкг/мл стрептомицина, 50 мкМ 2-меркаптоэтанола и 10?% фетальной телячьей сыворотки (FCS, "Life Technologus"), с добавлением рекомбинантного GM-CSF (10 нг/мл; "PeproTech") и рекомбинантного мышиного IL?4 (10 нг/мл; "PeproTech"). Все культуры были инкубированы при 37 °С в 5% CO2. Неприлипающие клетки удаляли после 48 ч культивирования, и добавляли свежую среду. После 7 дней культивирования более 90% клеток экспрессировали характерный для ДК маркер CD11c, который определяли проточной цитометрией. ДК отмывали и помещали в 24-луночные платы в концентрации 2???105 клеток на лунку в 400 мкл свободной от сыворотки RPMI-1640.

Синтез siRNA и трансфекция. Последовательность siRNA была подобрана в соответствии с описанным нами ранее методом [5]. siRNA, специфическая для IL12p35 (AACCUGCUGAAGACCACAGAU), INF? (AACTGGCAAAAGGATGGTGAC), и смешанная контрольная (mismatched) последовательность (AACTGCCAGATGGATGGTGAC) были синтезированы и ренатурированы производителем ("Dharmacon", USA). В концентрации 60 пкМ они добавлялись к культуре ДК. В качестве реагента трансфекции - носителя были использованы GenePorter ("Gene Therapy Systems", San Diego, CA) или липиодол (Ultra-Fluide, "Lab. Guerbet", France) Для проведения трансфекции 3 мкл 20 мкМ ренатурированной siRNA инкубировали с 3 мкл GenePorter или липиодолом в объеме 100 мкл RPMI-1640 (без сыворотки) при комнатной температуре в течение 30 мин. Затем добавляли к 400 мкл культуры ДК, приготовленной описанным выше способом. После 4 ч инкубации такие же объемы RPMI-1640, только дополненные 20?% FCS, были добавлены к клеткам. Через 24 ч после трансфекции ДК были отмыты и использованы для последующих экспериментов. Активацию ДК выполняли стандартным образом: в 24-луночных платах стимуляцией LPS (10 нг/мл; "Sigma-Aldrich") и TNF? (10 нг/мл; "PeproTech") в течение 24 ч.

Проточная цитометрия. Фенотипирование ДК выполняли на проточном цитометре FACScan ("Becton Dickinson") с использованием программы Cell Quest soft ware ("BD Biosciences"). Клетки окрашивали конъюгированными с ФИТЦ моноклональными антителами против поверхностных маркеров мыши, характеризующих созревание ДК: CD11c, CD40, CD80, CD86 ("Cedarlane Lab."). Иммуноглобулины тех же изотипов были использованы в качестве контроля. Результаты представлены в виде средней величины интенсивности флуоресценции (MFI), полученной для каждого варианта в трех независимых экспериментах.

Иммуноферментное определение цитокинов. Концентрацию цитокинов (IL?12p70, IL?10, IFN?, IL?4) в супернатантах клеточных культур определяли с помощью наборов реагентов ("Endogen", USA) и фотометра Benchmark Microplate Reader ("Bio-Rad", USA).

Смешанная культура лимфоцитов. ДК мышей C57BL/6 после трансфекции были облучены (3000 рад) и рассеяны триплетами в различных концентрациях в плоскодонные 96-луночные платы для использования в качестве клеток-стимуляторов. Т-клетки селезенки от мышей линии BALB/c выделяли градиентным центрифугированием на фиколл-паке ("Amersham Pharmacia Biotech", Canada), очищали через колонки с нейлоновой ватой и добавляли как отвечающие клетки в концентрации 5???105 клеток на лунку. Смешанные лимфоциты культивировали при 37 °С в течение 72 ч в 200 мкл RPMI-1640 c добавлением 10% FCS, 100 ЕД/мл пенициллина, 100 мкг/мл стрептомицина и за 16 ч до окончания культивирования добавляли 1 мкКи на лунку 3H-тимидина ("Amersham Pharmacia Biotech"). Клетки собирали на фильтры, и включение радиоактивности измеряли на жидкостном сцинтилляционном счетчике Wallac BetaPlate ("Beckman", USA). Результаты представлены в виде среднего числа импульсов в минуту в триплетах?+?m. В части экспериментов были добавлены анти-IL?10 антитела (JES52 A5, "Pharmingen") или изотипические контрольные антитела в концентрации 5 мкг/мл.

Статистический анализ. Статистическую обработку выполняли с использованием t-критерия Стьюдента для непарных данных, полученных проточной цитометрией. Результаты по определению продукции цитокинов и данные микст-реакции лимфоцитов были обработаны с использованием однофакторного дисперсионного анализа (one-way ANOVA/Newman-Keuls). Результаты представлены в виде среднего значения?+?m. Различия считали достоверными при p?"?0,05.

Ключевые слова: дендритные клетки, выключение гена, РНК интерференция (RNAi),короткие интерферирующие РНК (siRNA), цитокины.

Читайте статью целиком
в печатной версии журнала
!

Содержание | Следующая статья | Предыдущая статья

Подпишитесь на журнал "Цитокины и Воспаление" он-лайн!


Начата подписка на 2018 год!

Обновление на книжной полке: компакт-диск Цитокины и воспаление, 2008 год.

© 2002-2018 Цитокины и Воспаление